Page id: 254

Catalogue Products

 

Catalogue Products

Oligo Products

 

Random Hexamer

A Random Hexamer N6 is a six-base oligonuclotide sequence that is synthesised completely randomly. The six
N-wobbles (N= A, G, C, or T) provide a variety of possible sequences (46 possibilities) that can bind to many random positions of a single-stranded DNA or RNA sequence. 
The Random Hexamer serves as a universal primer that can be extended by DNA polymerase in the DNA synthesis or by reverse transcriptase during the cDNA synthesis. In this way, a cDNA pool with different cDNA lengths can be generated.

Art.no. Product Pack size
SP10000 Random Hexamer 6N (NNNNNN) 5 OD


The Random Hexamer can be ordered directly by e-mail. Please send us an e-mail to order@biomers.net stating the article number.

Oligo dT20

As an alternative to the Random Hexamer, an Oligo dT20 can also initiate the first strand cDNA synthesis by reverse transcriptase. Oligo dT20 consists of 20 deoxythymidines and can bind as a primer to the complementary poly A tail of eukaryotic mRNA. The reverse transcription reaction allows the synthesis of cDNA from the total RNA.

Art.no. Product Pack size
SP10001 Oligo dT20 1 OD
5 OD
10 OD


You can easily order the Oligo dT20 by e-mail. Please send us an email to order@biomers.net stating the article number and size of the package.

Universal Reporter

The following Universal Reporters with the corresponding fluorescent dyes are available (the mediator binding region is underlined in each case).
The internal dye is attached either via a dC (7) or dT (8) building block.

Art.no. Product int. Dye Sequence Pack size
UR10003 Universal Reporter URA Fam ATTGCGGGAGATGAGACCCGCAA8TGTTGGTCGTAGAGCCCAGAACGA 1 nmol
UR10004 Universal Reporter URB Hex GACCGGCTAAGACGCGCCGGT7TGTTGCACCTGGGACATCGACTAT 1 nmol
UR10005 Universal Reporter URC Rox GACCGCACTAGTAGATGCGGT7TGTCGTGGACCCTGTATCGAGCA 1 nmol
UR10006 Universal Reporter URD Cyanine 5 GACCGGCCAAGACGCGCCGGT7TGTTCACTGACCGAACTGGAGCA 1 nmol
UR10007 Universal Reporter URE Cyanine 5.5 GACGCGTAGTACAGAACGCGT7TGTTCAGTGAGCCTACCTGCCTTC 1 nmol


Further information about the Mediator Probe PCR can be found here.
Please order the Universal Reporter via email to order@biomers.net

RNase Substrate

For the simple detection of RNases, a short fluorescence-labelled probe can be used as a substrate:
6-Fam-dArUdAdA-BHQ1
In addition to three DNA bases, the probe also has a RNA base rU. In the absence of the RNase enzyme, the fluorescence of the 6-Fam is quenched. After digestion of the substrate at the labile bond at the base rU, the fluorophore and quencher are separated and the increase in fluorescence of the flourescent dye 6-Fam can be detected at 520 nm.

Art.no. Product Pack size
SP10002 RNase Substrate 10 nmol


Further information about the RNase substrate can be found here
The order will be sent directly by e-mail to order@biomers.net. 

 

qPCR Mastermix

 

qPCR Mastermix

biomers.net offers several qPCR mastermixes optimised for qPCR applications in block systems (e.g. ABI, Applied Biosystems, etc.). All necessary components for performing a quantitative PCR are included in the master mixes in an optimised amount.

Art.no. Product Pack size Download
MM10008 ProbeMasterMix (2X) High ROX Testsample Data sheet
2 x 1,25 ml
10 x 1,25 ml
MM10009 ProbeMasterMix (2X) No ROX Testsample Data sheet
2 x 1,25 ml
10 x 1,25 ml
MM10010 GreenMasterMix (2X) High ROX Testsample Data sheet
2 x 1,25 ml
10 x 1,25 ml
MM10011 GreenMasterMix (2X) No ROX Testsample Data sheet
2 x 1,25 ml
10 x 1,25 ml


All master mixes can be conveniently ordered by e-mail. Please send us an email to order@biomers.net stating the article number and size of the package. 

 

Chemicals for oligo synthesis

 

Phosphoramidites

Art.no. Product Pack size
PA10012 5´-Hydrazide Modifier Phosphoramidite 100 µmol
0,25 g


The order will be sent by e-mail to order@biomers.net. Simply enter the article number of the product and the desired package size.