Page id: 254

Catalog Products

 

Catalog Products

Oligo Produkte

 

Random Hexamer

Bei einem Random Hexamer N6 handelt es sich um eine Oligonucleotidsequenz von sechs Basen, die vollständig zufällig synthetisiert wird. Die sechs aufeinanderfolgenden N-Wobbles (N= A, G, C, oder T) ergeben eine Vielzahl von möglichen Sequenzen (46 Möglichkeiten), die an vielen zufälligen Abschnitten einer einzelsträngigen DNA- oder
RNA-Sequenz binden können. Das Random Hexamer dient dabei als universeller Primer, der durch die
DNA-Polymerase bei der DNA-Synthese oder mithilfe der reversen Transkriptase während der cDNA-Synthese verlängert werden kann. Auf diese Weise kann ein cDNA-Pool mit verschiedenen cDNA-Längen erzeugt werden.

Art.nr. Produkt Packungsgröße
SP10001 Random Hexamer 6N (NNNNNN) 1 OD
5 OD
10 OD


Das Random Hexamer können Sie direkt per E-Mail bestellen. Senden Sie uns bitte hierzu unter Angabe der Artikelnummer eine E-Mail an order@biomers.net.

Oligo dT20

Alternativ zum Random Hexamer kann auch ein Oligo dT20 die Synthese eines cDNA-Erststrangs mittels reverser Transkriptase initiieren. Oligo dT20 besteht aus 20 Desoxythymidinen und kann als Primer komplementär an den poly A Schwanz von eukaryotischer mRNA binden. Die reverse Transkriptionsreaktion ermöglicht damit die Synthese von cDNA aus der Gesamt-RNA.

Art.nr. Produkt Packungsgröße
SP10002 Oligo dT20 1 OD
5 OD
10 OD


Das Oligo dT20 können Sie bequem per E-Mail bestellen. Bitte senden Sie uns unter Angabe der Artikelnummer und Packungsgröße eine E-Mail an order@biomers.net

Universal Reporter

Die folgenden Universal Reporter mit den entsprechenden Fluoreszenzfarbstoffen stehen standardmäßig zur Verfügung (unterstrichen ist jeweils die Mediatorbinderegion).
Die Anbindung des internen Farbstoffes erfolgt entweder über einen dC- (7) oder dT-Baustein (8).

Art.nr. Produkt int. Farbstoff Sequenz Packungsgröße
UR10001 Universal Reporter URA Fam ATTGCGGGAGATGAGACCCGCAA8TGTTGGTCGTAGAGCCCAGAACGA 1 nmol
UR10002 Universal Reporter URB Hex GACCGGCTAAGACGCGCCGGT7TGTTGCACCTGGGACATCGACTAT 1 nmol
UR10003 Universal Reporter URC Rox GACCGCACTAGTAGATGCGGT7TGTCGTGGACCCTGTATCGAGCA 1 nmol
UR10004 Universal Reporter URD Cyanine 5 GACCGGCCAAGACGCGCCGGT7TGTTCACTGACCGAACTGGAGCA 1 nmol
UR10005 Universal Reporter URE Cyanine 5.5 GACGCGTAGTACAGAACGCGT7TGTTCAGTGAGCCTACCTGCCTTC 1 nmol


Weitere Informationen zur Anwendung der Mediator Probe PCR finden Sie hier.
Die Bestellung der Universal Reporter erfolgt per E-Mail an order@biomers.net

RNase Substrat

Zum einfachen Nachweis von RNasen kann eine kurze fluoreszenzmarkierte Sonde als Substrat genutzt werden:
6-Fam-dArUdAdA-BHQ1
Neben drei DNA-Basen besitzt die Sonde noch die RNA-Base rU. In Abwesenheit des Enzyms RNase wird die Fluoreszenz des 6-Fam durch den in unmittelbarer Nähe befindlichen Quencher gelöscht. Nach RNase-Spaltung des Substrats am rU sind Fluorophor und Quencher getrennt und der Anstieg der Fluoreszenz des 6-Fam kann bei
520 nm detektiert werden. 

Art.nr. Produkt Packungsgröße
SP10003 RNase Substrat 10 nmol


Weitere Informationen zum RNase Substrat finden Sie hier
Die Bestellung erfolgt direkt per E-Mail an order@biomers.net. 

Smart-seq2 Oligonucleotide (TSO, dT30VN, ISPCR)

Beim Smart-seq2, ein Verfahren zur Herstellung von Full-Length cDNA und Sequenzierbibliotheken, die eine verbesserte Sensitivität und Genauigkeit für Transkriptom-Analysen aus einzelnen Zellen aufweisen, kommen bestimmte Olignucleotide zum Einsatz. 

Art.nr. Produkt Sequenz Packungsgröße
SP10004 TSO Oligo AAGCAGTGGTATCAACGCAGAGTACAT667
6: rG; 7: +G (Locked Nuc Acid)
1 OD
SP10005 Oligo-dT30VN AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN 1 OD
SP10006 ISPCR oligo AAGCAGTGGTATCAACGCAGAGT 1 OD


Weitere Informationen zum Smart-seq2 Assay sowie ein detailliertes Protokoll finden Sie hier
Die Bestellung erfolgt direkt per E-Mail an order@biomers.net. 

FLAP-Sonden zur smiFISH mRNA-Detektion

smiFISH benötigt neben den Target-spezifischen Primärsonden eine fluoreszenzmarkierte Sekundärsonde (FLAP).
Hierbei stehen drei verschiedene FLAP-Sonden (FLAP X, FLAP Y oder FLAP Z) zur Auswahl. Jede Sekundärsonde wird jeweils am 5´- und 3´-Ende mit einem Fluoreszenzfarbstoff markiert. 

Art.nr. Produkt Sequenz Packungsgröße
SM10001 FLAP X (Fam) CAC TGA GTC CAG CTC GAA ACT TAG GAG G 1 OD
SM10002 FLAP X (Cyanine 3) CAC TGA GTC CAG CTC GAA ACT TAG GAG G 1 OD
SM10003 FLAP X (Cyanine 5) CAC TGA GTC CAG CTC GAA ACT TAG GAG G 1 OD
SM10004 FLAP Y (Fam) AAT GCA TGT CGA CGA GGT CCG AGT GTA A 1 OD
SM10005 FLAP Y (Cyanine 3) AAT GCA TGT CGA CGA GGT CCG AGT GTA A 1 OD
SM10006 FLAP Y (Cyanine 5) AAT GCA TGT CGA CGA GGT CCG AGT GTA A 1 OD
SM10007 FLAP Z (Fam) CTT ATA GGG CAT GGA TGC TAG AAG CTG G 1 OD
SM10008 FLAP Z (Cyanine 3) CTT ATA GGG CAT GGA TGC TAG AAG CTG G 1 OD
SM10009 FLAP Z (Cyanine 5) CTT ATA GGG CAT GGA TGC TAG AAG CTG G 1 OD


Weitere mögliche Fluoreszenzfarbstoffe finden Sie hier. Weitere Informationen zur Anwendung smiFISH finden
Sie hier. Die Bestellung erfolgt direkt per E-Mail an order@biomers.net.

 

qPCR Mastermixe

 

qPCR Mastermixe

biomers.net bietet verschiedene qPCR Mastermixe an, die für die qPCR in Blocksystemen (z.B. Geräte von ABI, 
Applied Biosystems, etc.) optimiert wurden. Alle notwendigen Komponenten zur Durchführung einer quantitativen PCR sind in den Mastermixen in einer optimierten Menge enthalten.

Art.nr. Produkt Packungsgröße Download
MM10001 ProbeMasterMix (2X) High ROX Testsample Datenblatt
2 x 1,25 ml
10 x 1,25 ml
MM10002 ProbeMasterMix (2X) No ROX Testsample Datenblatt
2 x 1,25 ml
10 x 1,25 ml
MM10003 GreenMasterMix (2X) High ROX Testsample Datenblatt
2 x 1,25 ml
10 x 1,25 ml
MM10004 GreenMasterMix (2X) No ROX Testsample Datenblatt
2 x 1,25 ml
10 x 1,25 ml


Alle Mastermixe können Sie bequem per E-Mail bestellen. Bitte senden Sie uns unter Angabe der Artikelnummer und Packungsgröße eine E-Mail an order@biomers.net

 

Chemikalien für die Oligonucleotid-Synthese

 

Phosphoramidite

Art.nr. Produkt Packungsgröße
PA10001 5´-Hydrazid Modifier Phosphoramidit 100 µmol
0,25 g


Die Bestellung erfolgt per E-Mail an order@biomers.net. Geben Sie hierbei einfach die Artikelnummer des Produktes und die gewünschte Packungsgröße an.