Page id: 105

Antisense Oligos
 

Antisense oligonucleotides are short, synthetic single-stranded chains of nucleic acids. Similar to the siRNA, antisense oligonucleotides bind to a matching sequence via complementary base pairing. Hybridising the antisense oligos to the complementary mRNA sterically hinders translation and thus the biosynthesis of specific target proteins. The RNA strand bound by the oligonucleotide is specifically detected by the RNase H enzyme and cleaved, releasing the antisense oligonucleotide, enabling the binding of further complementary strands. 
Regarding the siRNA, one strand of siRNA binds to the complementary mRNA, which is then degraded of a complex of several proteins, called RISC (RNA-induced silencing complex). Concerning the siRNA, the translation and the synthesis of the proteins are thus inhibited.

On carrier molecules, mostly lipids, the uptake and subsequent distribution in the cell can be improved. In the cell, oligos can have a therapeutic effect at two different levels: on the one hand by the selective inhibition of translation by which subsequently the synthesis of the target proteins is prevented. On the other hand, particular sequences (so-called CpG-dinucleotide rich or just CpG-oligos) may cause a non-specific immune response in eukaryotes by mimicking a “bacterial infection”. Additional modifications such as the attachment of phosphorothioates, may enhance these immune responses additionally. 



Literature:
- An antisense oligonucleotide primer. Hogrefe RI; Antisense and Nucleic Acid Drug Development (1999), 9(4): 351-357. 

- Prospects for nucleic acid-based therapeutics against hepatitis C virus.  Lee CH, Kim JH, Lee S-W. World J Gastroenterol. (2013), 19(47): 8949–8962.

- CpG-A and CpG-B oligonucleotides differentially enhance human peptide–specific primary and memory CD8 T-cell responses in vitro. Rothenfusser S, Hornung V, Ayyoub M, Britsch S, Towarowski A, Krug A, Sarris A, Lubenow N, Speiser D, Endres S, Hartmann G; Blood (2004), Vol.103, Number 6.

- CpG-A Oligonucleotides Induce a Monocyte-Derived Dendritic Cell-Like Phenotype That Preferentially Activates CD8 T Cells. Krug A, Rothenfusser S, Selinger S, Bock C, Kerkmann M, Battiany J, Sarris A, Giese T, Speiser D, Endres S, Hartmann G;. J Immunol (2003), 170:3468-3477.

Phosphothioate

Phosphothioat-Oligonucleotide (Phosphorothioat, PTO)

 

The phosphorothioate modification of the DNA backbone is one of the first and still widely used modification for antisense oligonucleotides (antisense oligos of the first generation). In the phosphate backbone, one of the two oxygen atoms which is not involved in the internucleotide bridge, is replaced by a sulfur atom (Fig.). Due to the four different substituents, the central phosphorus atom is a chiral center which effects diastereomer formation.
In oligonucleotides, all (Full-PTO) or just single phosphates (Part-PTO) can be replaced by phosphorothioate. Often it seems to be sufficient to incorporate two to four PTOs at the end of the oligos to achieve the desired stability against degradation.

Phosphothioat oligonucleotide (PTO)



Order information:

Phosphorothioates are presented in the order system of biomers.net by asterisks (*). If all or just single phosphodiester should be replaced by phosphorothioates, a * have to be inserted into the sequence at the respective position.

Examples: 

  • A normal sequence without phosphorothioates:
    agcgtgacgtggacgtgagtga
  • The identical sequence, but as a "full-PTO-oligo" (all inter-nucleotidic phosphodiester were changed to PTO):
    a * g * c * t * g * g * a * c * t * g * g * g * a * c * t * g * g * a * g * t * g * a 
  • The sequence with single PTOs, in this case three PTO at both ends:
    a * g * c * gtgacgtggacgtgag * t * g * a 
  • The sequence with a PTO-bridge at the 3 'end:
    agcgtgacgtggacgtgagtg * a

If a PTO-Oligo should be modified at one end, for example with a fluorescent dye, it is often useful, to "stabilize" also the phosphate bridge between the oligo and the modification (synthesizing as a PTO). 
At a 5'-modification, in this case a * is also added to the 5'-end of the oligos (at a 3'-modification according to the 3'-end) and the desired modification is selected in the menu:

  • * a * g * c * t * g * g * a * c * t * g * g * g * a * c * t * g * g * a * g * t * g * a, 5'-modification: biotin: PTO between biotin and oligo
  • a * g * c * t * g * g * a * c * t * g * g * g * a * c * t * g * g * a * g * t * g * a, 5'-modification: biotin:  phosphodiester between biotin and oligo

2´-modified RNA 

2´-modified RNA 


This RNA has modifications at the 2'-position of ribose. biomers.net offers here a selection of different modifications:

  • 2´-OH
  • 2´-O-Methyl
  • 2´-O-Propargyl
  • 2´-O-Propylamin
  • 2´-Amino
  • 2´-Fluoro


By definition it is a ribose if an oxygen is linked at 2´-carbon of the sugar. This does not mean that this ribose may bear the base thymine (instead of uracil).

2ยด-modified RNA

Antisense oligonucleotides having a modification at the 2'-hydroxyl group (2´-methyl), often show an increased stability to enzymatic degradation. This also facilitates an improved distribution of the oligos in the cell, as well as improved pharmacokinetics of the antisense oligos can be derived1. Furthermore, it was observed that 2'-modified oligonucleotides (2´-O-methyl, 2´-O-propyl, 2´-O-fluoro) bind with greater affinity to complementary RNA2.

Please contact the biomers.net customer support for availability and delivery times.
Tel +49 731 70 396 0 | info@biomers.net



Literature:
1. Pharmacokinetic Properties of 2´-O-(2-Methoxyethyl)-Modified Oligonucleotide Analogs in Rats. Geary RS, Watanabe TA, Truong L, Freier S, Lesnik EA, Sioufi NB, Samor H, Manoharan M, Levin AA; The Journal of Pharmacology and experimental Therapeutics (2001), Vol. 296, No. 3; JPET 296:890–897.

2. Evaluation of 2´-Modified Oligonucleotides Containing 2’-Deoxy Gaps as Antisense Inhibitors of Gene Expression. Monia BP, Lesnik EA, Gonzalez C, Lima WF, McGee D, Guinosso CJ, Kawasaki AM, Cook PD, Freier SM; The Journal of Biological Chemistry (1993), Inc. Val. 268, No. 19, pp. 14514-14522.

Chimera

Chimeric oligonucleotides


Chimeric oligonucleotides can be made from various types of building blocks. In contrast to naturally occurring molecules, synthetic oligos can simultaneously consist of DNA and RNA. It is also possible that these oligos are mixed from right- and left-handed components (see L-DNA). Furthermore, mixtures are possible with reverse building blocks, whereby molecules can be generated that terminate at both ends with 3 'or 5'. 

Please contact us for any further information.



Literature:
- An Antisense Oligonucleotide Primer. Hogrefe RI; Antisense and Nucleic Acid Drug Development (1999), 9(4): 351-357. 

Modifications

Antisense Oligonucleotide Modifications 

 

Poor pharmacokinetic properties and ineffectual uptake of oligonucleotide conjugates to the cell often represent the greatest difficulties for a successful development of new oligonucleotide-based therapeutics. 

In terms of antisense oligonucleotides, a wide variety of modifications are available. Matched to the researcher´s particular method, various internal or terminal changes of an oligonucleotide are possible. Small lipophilic molecules which can be attached to an oligonucleotide may facilitate the passage of the highly negatively charged DNA or RNA through the cell membrane and thus the uptake into the cell.

Small lipophilic molecules which can be attached to oligonucleotide, allow the passage through the cell membrane and thus the uptake into the cell of the highly negatively charged DNA or RNA. The attachment of cholesterol or tocopherol to DNA or RNA molecules may improve the stability and the distribution of the conjugates in the cell1 (Lipophilic Modifications).

Tocopherol and Cholesterol

Modifications which may also inhibit the degradation of the oligos by nucleases are inverted-ends. A further nucleotide is attached "upside down" to the 3'-terminal nucleotide so that the oligonucleotide has a 5'-terminus on both sides. Besides protection against digestion, this modification efficiently blocks elongation during PCR. 


 
inverted end


biomers.net offers in terms of antisense oligos to a wide range of ligands and further modifications. Our experienced support team will help you any time at all aspects of the selection and use of your specific oligonucleotides.



Literature:
1. Oligonucleotide conjugates for therapeutic applications. Winkler J; Ther. Deliv. (2013), 4(7),791-809.