Page id: 23

Frequently Asked Questions 
 

- Products and Service -
 

Your research is important to us. 
If you have any questions or uncertainties in realisation of your personal project, please do not hesitate to contact our experienced and professional customer support team. We are pleased to help and advise you in choosing your individual oligonucleotides. Your satisfaction and confidence in us and our products are very important to us!

Order

 

How can I order oligos from biomers.net?

We offer several different ways to order oligos:

•   Online order system
Ideally you order directly through our convenient online ordering system. The online ordering ensures the quickest processing of your orders. The interactive feature of the online order form can immediately clarified and implemented many requests, since only valid modifications, scales or purification options can be selected here. In this way, questions and delays can be avoided and your oligos are directly and quickly forwarded to the synthesis.

Another advantage of our service is the online archive. Using this archive you get an overview of previous orders and have the option to re-add single, already ordered oligos to a new order list.
If you also save your orders before sending it to us, you have the possibility to combine several oligo orders and send it to us later. Setting up a common account also enables the coordination of multiple orders. By allowing the access to several people to a common biomers.net account in your department, single oligos can be added to the current order list and finally sent as an entire order. 
Online order  

•    Bulk order sytem
Using our bulk online form you can order easily a large number of oligonucleotides with the same scale and purification, differing only in their name and sequence. 
Bulk order system

•    Excel order form
Still another convenient opportunity to order oligonucleotides is the Excel order form. Especially for oligonucleotides with modifications, scales or purifications, which cannot be entered in the online order form, the Excel order form offers the possibility to enter your special requests in the appropriate line.
Please send the completed order form to order@biomers.net. 
You can download the Excel order form here . 
 

How do I order oligos with degenerate/wobble bases?

A mixture of several different bases (2-4) is commonly known as wobble bases or degenerate bases. 
The following internationally valid "one letter code" shows the possible wobble combinations of the four 
standard bases. Please use this code when ordering oligonucleotides with degenerate bases.

Code W S M K R Y B D H V N
Combination of bases AT CG AC GT AG CT CGT AGT ACT ACG ACGT
 

In Addition to the standard wobble base mixtures (each base in the same ratio) you can also specify wobbles in a specific base ratio in your order. Please let us know your desired wobble base ratio by sending an e-mail. 
For more detailed information about this topic click here. 

How do I order PTOs (Phosphorothioate)?

You may order oligonucleotides as Part- or Full-PTO. In Part-PTO only some individual phosphates are replaced by phosphorothioates, in full PTO, however, all phosphates are replaced. To stabilise the oligonucleotide against degradation the incorporation of two to four PTOs at the ends of the respective oligos is generally considered to be sufficient.
Please enter phosphorothioates with asterisks (*) in your sequence and insert it into the sequence at the respective position.

Example:

•    A "normal" sequence without phosphorothioates: 
agcgtgacgtggacgtgagtga

•    The identical sequence, but as "Full-PTO-oligo" (all inter-nucleotidic phosphodiester were changed to PTO):
a*g*c*g*t*g*a*c*g*t*g*g*a*c*g*t*g*a*g*t*g*a

•    The sequence with single PTOs ("Part-PTO"), in this case three PTO at both ends:
a*g*c*gtgacgtggacgtgag*t*g*a

•    The sequence with one PTO-bridge at the 3´-end:
agcgtgacgtggacgtgagtg*a

Note: If not explicitly ordered differently, an oligo has no phosphate at the termini, thus, PTOs can only be placed between the bases, not at the ends. However, if a PTO-oligo should be additionally modified at one end, for example with a fluorescent dye, it is often useful to “stabilise” also the phosphate bridge between the oligo and the modification. In your online order, just insert a * at the respective modified end and select the desired modification in the menu. 

How do I order internal sequence modifications (dI, dU)? 

Please enter deoxyinosine and deoxyuridine as well as ribo-bases and other modified bases (5-hm-dU, 5-Br-U, 5-Br-dU, 2'-F-dU, 2'-OMe-U, etc.) as internal modifications in the online order form.
To do this, symbolise the desired position of your internal modification in the sequence by the numbers (5-8) that mark the respective pulldown menu.
For internal modifications that are A / G / C / T replacements, please kindly assign them as follows: 
A - 5, G - 6, C - 7, T - 8
In addition, make sure that neither the scale "XS" nor the purification "cartridge" is selected. Both settings cannot be applied to modifications.


                            

If you need more information about deoxyinosine and deoxyuridine just visit our website. 

Are several modifications possible in an oligo?

biomers.net offers a wide range of modifications. Depending on your needs, you can select the right modifications, tailored perfectly to your research.
Terminal as well as internal modifications are possible in an oligonucleotide. Please note, however, the more complex the modifications and the number of selected combinations in an oligonucleotide, the more expensive and complex the synthesis. Also the synthesis yield tends to decrease more with multiple modified oligos.
If in doubt, please feel free to contact us at any time. Our customer support team will be happy to help you placing an order with complex or multiple modifications. 

The selection of my desired modification is not possible in the online order form

Not all modifications available with us can be attached to an oligo in any conceivable combination. According to this, only valid modifications, scales, purifications, etc. can be selected in our online order form. Prohibited or not optimal combinations are not shown in the corresponding pulldown menu line.

                            

If you are not able to select any modifications, please make sure that neither the scale "XS" nor the purification "cartridge" have been selected, as both settings cannot be combined with modifications. 
If you want to insert one or more modifications in your oligonucleotide, but the selection of the respective modifications is not possible in the order form, please do not hesitate to contact our customer support team at any time. 
We will be happy to provide consulting, help you selecting the appropriate modifications and show you alternatives that ensure an optimisation of your results. In many cases, it makes sense to send us the specific sequence of your oligo by mail, so that our experienced synthesis specialists and chemists are able to identify difficulties in synthesis and can thus better respond to them. 

How do I change or cancel my order?

You have already submitted your order and you still need another oligo now? You want to change your order, which is already sent or even cancel it? 

•    Add oligos 
If you want to add another oligo after submitting your order, please let us know as soon as possible, preferably by e-mail or phone call. We will gladly add a further oligonucleotide to your order. 
In case that your oligos are already forwarded to the synthesis, we will summarise all your oligos after synthesis and send it as an entire order, so that no additional shipping costs arise for you. 

•    Change 
Please contact us as soon as possible by mail or phone call if any order change is necessary. 
After submitting your order, changing is only possible for a very short time.
Due to the fact that we want to ensure a fast delivery of your oligonucleotides, only a few minutes elapses, sometimes only seconds, between order entry and start of the synthesis. 
Changes that are received within this time can still be processed by us. 
However, once you get the order confirmation (PDF) from us, your syntheses have started and a change is not possible anymore. 
Unfortunately later incoming notifications from you cannot be considered. In this case, we can only summarise your orders (old and new) and ship them together after synthesis. 

•    Cancel
If you wish to cancel your order, this is also only possible by a very timely notification. 
Similar to the changes of an order, cancellations are only possible if you have not received the order confirmation (PDF) from us. Once you have this, the synthesis has already started and a cancellation is not possible. 

Use of discount codes

If you have received a biomers.net discount, simply specify it in your next order and the deposited discount will be deducted from your bill. 

•    Online order form
Please enter your oligonucleotide and all relevant details (name, sequence, modification, scale, purification, etc.) and add it to your order list ("Add oligonucleotide to order list"). At "Order-related information" in the line "Discount code" insert your discount code and redeem it.

                            


•    Bulk order form 

After entering and uploading the Excel file, the online order form opens. Add the oligos to the order list, then the discount code may be inserted and redeemed under "Order-related information" in the line "Discount code" (see figure above). 

•    Excel order form
When using the Excel order form, enter your discount code in the line "Offer code". 

Indication of PO number (forgot the PO number when placing the order)

If your administration assigns a purchase order number to process your orders correctly, we will gladly add this number to the accompanying documents of your order. To do this, please insert your purchase order number in the online order form under "Order-related information" in the line "Your purchase order no". 
If you have forgotten your internal PO number in your order, please inform us as soon as possible, preferably by mail, and we will add your PO number to your order. 
To allow a simple assignment, please refer to your order number (PAN) or to the internet order number (InetOrderNo). As long as your order is being processed, we may still insert the PO number in your order. 

                             

VAT number

Orders from member states of the European Union must include the specific individual VAT number (tax number), otherwise the German VAT has to be paid (currently 19%). 

Order confirmation

After submitting your order, you will always receive a confirmation of your order by e-mail. This includes again all the data of your ordered oligonucleotides, such as name, sequence, length, scale, etc. The visibility of the sequence of your oligos in the confirmation e-mail can be chosen during the ordering process in the online order form at "Order-related information".

                            

After processing your order in our system, within minutes your order is forwarded internally to synthesis and you finally get an automatically generated order confirmation.
Please check it for accuracy of your delivery and billing address, and please let us immediately know any discrepancies or errors.
Please note that upon receipt of your order confirmation (PDF), no changes can be made. 

Order tracking

The live tracking is possible for all orders that have reached us through the online portal. To access this, simply sign up with your account data on our website and track your order "live" with your personal order tracking code. After ordering you will obtain your tracking code by e-mail. Your order tracking information is available within 1 h during our business hours, otherwise on the morning of the next working day. 
Using this option, you always get the latest information about the status of production of each single oligonucleotide (e.g. "synthesis", "quality control", etc.). After shipment, your order will be linked with the DHL website. Here you can view the current status of delivery.
Order tracking  

Order history

Storing, sorting or export your data in your oligo order archive.
Using our order archive will allow an overview of all orders you have previously ordered through our online order form. 
The order archive collects data from your online orders automatically, all order connected data and documents are available, any lost data sheets can be downloaded again at any time.
You have the possibility to unlock the order archive for other people, so you can jointly manage your orders and data sheets. 
Order archive  

Nomenclature of biomers.net ID numbers

•    InetOrderNo 
The order number assigned by our web order system. 
This number identifies your order in our web order system and is also used internally by the order tracking and your order history. You will find this number in the information e-mail which our web order system has sent you when you submitted your order.
The following numbers and identifiers are used at biomers.net in connection with your oligonucleotide order:

•    Production number (1): The production number is used to uniquely identify your oligonucleotide through the entire production process as well as in case of inquiries regarding that oligo. The production number is also printed on the product labels and quality certificates encoded as a bar code.

•    PAN (=ProduktionsAuftragsNummer, German for "production order number") / order code (2): This eight-digit number uniquely identifies your order in our production control system as well as in our accounting. Thus, this number is the most important number to identify your order. It is given on all quality certificates, delivery notes and invoices as well as on the product labels you receive from biomers.net.

•    Oligo number (3): The sequential number of an oligonucleotide inside an order. The combination of PAN and oligo number, the so-called oligo ID, uniquely identifies a single oligonucleotide. The oligo numbers in your order can have gaps due to order editing; due to re-numbering during the import of a web order in our production system the sequential numbers in your web order can differ from the ones in the finalised production order. The latter are the relevant numbers. 

    

Prices and offers

You can find all prices in our price list. If you have any questions about our prices or want to know the price for special or complex modifications, please do not hesitate to contact us. 
Price list

For individual offers, please contact directly our customer support team. If needed, your request will be reviewed by our synthesis specialists. In this way, we can also realise rare, not quite "everyday" modifications or custom modifications according to your personal wishes. 
info@biomers.net 

Early Bird Discount 

On all orders reaching us between 6:00 am and 9:30 am (CET, depending on time of year with DST) our special Early Bird Discount will automatically grant 5% discount on all articles (excluding shipping costs). This is independent of other discounts (if not stated otherwise) and will apply only for online orders (or electronically readable Excel order forms). 
 

Synthesis and storage

 

How does the synthesis of my oligos work and how long does it last?

Upon receipt of your order you will receive an order confirmation and your oligo is forwarded immediately to the synthesis. With the start of the syntheses the necessary chemicals, equipment and materials for the respective synthesis are set and "activated", so that changes are no longer possible. Therefore, no changes or cancellations in the order can be made upon receipt of your order confirmation (PDF).
Our oligonucleotides are synthesised with phosphoramidite chemistry (Caruthers MH et al., 1983). To get technical information about the exact synthesis of an oligonucleotide sequence, click here.

Our quality management system is ISO9001 certified and guarantees in this way consistently high quality that you can trust in your research.

Estimated values of the synthesis time:

Oligonucleotide  Time of synthesis
Unmodified oligonucleotide 1-2 working days
Modified oligonucleotide  3-5 working days
RNA oligonucleotide 10-14 working days


However, please note that the expected time of synthesis is only an approximate value and not an exact date of completion or delivery.

The quality of your oligos is important to us!
For this reason, we only deliver oligos that have successfully passed the quality control. If deviations in quality were observed, a new synthesis is initiated immediately. Of course this will not be charged again.
In order to meet our high quality standards and that you achieve the best results in your research with our products, we only send high-quality oligonucleotides. So please understand that we cannot give you an exact delivery date.
All our orders will be processed and sent to you as quickly as possible. For shipments abroad, customs processes may delay the delivery. Regrettably we cannot influence such processes and advice to closely track your shipment.

Which purification methods can I choose?

biomers.net offers different methods of purification of oligonucleotides: 

•    cartridge 
•    HPLC
•    PAGE

Please note, that not every method of purification can be used for each oligo. Oligos modified with fluorescent dyes are HPLC purified by default. For non-modified oligos, however, different cleaning may be useful depending on the length and use.
To get more detailed information about our purification of oligonucleotides, click here. 

What is the meaning of synthesis scale and synthesis yield?

The synthesis scale indicates the amount of starting material (CPG), which is used at the beginning of the oligonucleotide synthesis (solid phase synthesis). The synthesis scale does NOT refer to the expected final yield. 
The final yield of an oligonucleotide depends on the length of the oligos, purification, possible modifications and possibly the base composition. Typically, the final yield of an oligonucleotide is determined by measuring its optical density (OD value). The OD value is measured experimentally and allows calculating the amount (nmol) and the mass (µg) of the oligo. 

biomers.net offers the following synthesis scales and synthesis yields:

Scale XS S M L XL
Starting material 0,02 µmol  0,05 µmol 0,2 µmol 1,0 µmol 10,0 µmol
Yield (OD)  2 OD  3-5 OD 10-20 OD  30-60 OD 200-400 OD
 
Scale XXL10MG XXL25MG XXL50MG XXL100MG XXL250MG XXL500MG
Starting material (20mer) 1,5 µmol 3,5 µmol 7,5 µmol 15 µmol 38 µmol 77 µmol
Yield (OD) 350 OD 850 OD 1700 OD 3400 OD 8500 OD 17000 OD
 

For all scales, we guarantee a minimum amount that we provide you. In the case of scale XS-XL the delivered minimum amount is given in OD; in the scale XXL, it is the amount in mg. So we guarantee, for example, in the scale XXL25MG a minimum of 25mg. 
According to our experience, the actual delivery amounts exceed the guaranteed yields significantly, certainly we deliver the total yield. 

Why do I get for multiple orders of the same oligos different synthesis yields (OD)? 

Many factors can affect the final yield of an oligonucleotide. As already mentioned, the synthesis yield depends on the composition of sequence and the length of the oligo. Reasons for different yields are alteration in the loading of the carrier material or in following procedures (e.g. precipitation of the oligos). 

What is the OD?

In a spectrophotometer, the purity of DNA is determined by the ratio of the wavelength of 260 nm and 280 nm. The resulting OD value at 260 nm is the absorbance of the sample. This value results from the measurement of absorption at an appropriate wavelength in 1 ml of aqueous solution in a 
1 cm quartz cuvette. A ratio of approximately OD260=1,8 is generally referred to "pure" DNA. RNA, however, has a higher value of OD260=2,0. 
Contamination with proteins, phenol or other substances leads to an increase of this value. 
The situation is different in the case of oligonucleotides. In contrast to DNA extracted from cells, the synthetic oligos are not in contact with proteins, so that the measurement at 280 nm is not applicable.
Another non-negligible point of oligonucleotides differing from long DNA or RNA molecules is the possibly unequal distribution of the four bases (A, C, G, T or U).
Each nucleotide has its own absorption maximum (see pictures below). Due to the short length of the oligonucleotides a bias for one kind of base may affect the "overall" OD, thus, the absorbance values of the bases must be included in the calculation.
When analysing oligonucleotides with a spectrophotometer, this special aspect should always be respected.                                 

The extinction coefficient Epsilon ɛ260  is different for every sequence of oligonucleotide and can be determined relatively accurate by the so-called Nearest-Neighbor method. It corresponds in a good approximation to the sum of the extinction coefficients of the nucleotides present in the sequence.
Using the data of sequence and the OD values, the amount n can be calculated. 

Base Monomer-extinction coefficient at 260 nm [mM-1 cm-1]
Adenine  1,54
Cytosine 0,75
Guanine   1,17
Thymine 0,92
 

n [nmol]=  (100 ∙ E260 nm)/(1,54 ∙ A + 1,17 ∙ G + 0,75 ∙ C + 0,92 ∙ T)

In response to the length of the oligo, the following values of amount [nmol] arise for oligonucleotide sequences with a uniform distribution of the four bases:

OD value                                                     Length of oligo [number of nucleotides]
  10 20 30 40 50 60 70 80 90 100
1 9,4  4,7  3,1  2,3 1,9 1,6  1,3 1,2 1,0  0,9
3 28  14 9 7 5,6  4,7 4,0 3,5 3,1  2,8
10 94  47 31 23  19 16 13 12 10  9
25  234  117 78 59  47 39  33 29 26 23
100 937 468 312  234 187 156 134 117 104 94
 

Example of calculation: 

Sequence: AGGTCCTTAGGCTGACGTTAAGCCTA
nA=6    nC=6    nG=7    nT=7
OD=10 (experimentally measured)

n [nmol]=  (100 ∙10)/(1,54 ∙6+1,17 ∙7+0,75 ∙6+0,92 ∙7)=35,25

With the amount [nmol] and the molecular weight [g/mol] of the oligonucleotide the amount of oligonucleotide [µg] can be calculated:

n [µg]=(n [nmol]∙MW_Oligo  [g/mol])/1000
MWOligo=313,2∙A+329,2∙G+289,2∙C+304,2∙T+MWmod-62 [g/mol]  

A,C,G,T: Number of bases present in the oligo
MWmod: Molecular weight of a modification, if present

How stable are my oligos and how should I store them? 

As the stability mainly depends on the storage conditions and in rare cases also on the sequence, no guaranteed shelf-life can be given. However, generally, properly stored and handled oligos are extremely stable. If you follow a few simple rules, you can use your oligonucleotides for a long time without any problems.
Find out more. 

Delivery

 

Delivery and shipping costs

Each order will be processed as fast as possible so that the waiting time is reduced to a minimum. You will be informed automatically about the shipment of your oligos. 
Choose the shipping method in your order. Within Germany packages will be sent with DHL or UPS by default. In the order form also other, faster delivery options are available against extra charge. If you require a UPS express delivery, please indicate this in the order form by selecting the corresponding pulldown menu.

                     

Deliveries within the city of Ulm will be delivered free by bicycle courier service. 
Deliveries outside of Germany will be sent by Fedex.
Shipping costs. 

How long does the delivery take within Germany and the EU?

Within Germany you will receive your ordered products within 1-2 working days with DHL or UPS. 
Orders within Ulm are always free of shipping. Your order will be delivered by bicycle courier service after completion of synthesis in the morning of the next business day. 
Deliveries to EU member states take place with the delivery company Fedex and take ca. 1-2 working days. 
If you or your institution have a VAT number, please enter it in your order. 

Delivery outside the EU

Deliveries outside the EU will be carried out with the company Fedex. Bigger cities were supplied worldwide usually within 2 working days, otherwise the average delivery time is 2-5 working days. 
In the case of deliveries outside the EU extra fees such as taxes, duties and processing fees may apply additionally to the normal/usual shipping charge. 
All orders will be processed and shipped to you as quickly as possible. For shipments abroad, it may be delayed by customs that we cannot influence.  

Delivery state 

Oligonucleotides can be delivered in two different states:

-in lyophilized (dried) state or
-solved in a solvent with specific concentration 

We recommend delivery in dried state, as in this way oligonucleotides have the maximum stability. In the dry state oligos are extremely stable and are unlikely to be harmed at RT or 4°C. In the longer term it is recommended to store oligonucleotides at -20°C. In the dissolved state oligonucleotides are particularly vulnerable to degradation by nucleases, for which reason the storage at -20°C is recommended since the activity of nucleases is minimised. Frequent thawing and refreesing also may affect the quality and stability of the solutions and should therefore be largely avoided. 3-5 cycles are generally considered to do no harm.
More detailed information about the topic of dissolving and storage of oligos is provided at our website. 
Find out more. 

Delivery notification

After successful synthesis and quality control of each oligo you will be informed automatically when your shipment data are transmitted electronically to the courier. In this way, you are always up to date and can optimally plan your further experiments. 

Delivery of digital order-related documents by e-mail

The delivery of order-relevant documents is now also possible by e-mail.
Now, you can send invoices and/or quality certificates (PDF) by e-mail to your invoice-related e-mail address. You can indicate this either in your user profile or directly during the online order under "Delivery method for order-related documents".
Please note, the invoice by e-mail will replace the paper form. The paper version will no longer be sent. 
                      
                          


Some remarks regarding email security:

Please mind that email is generally not a secure way of communication.

biomers.net uses so-called opportunistic encryption on its mail servers. This is a widely-used method where transmitted data is being encrypted given that the receiving mail server of your institution or company also offers this functionality. However, this method can not ensure that the receiving party is really who it says it is, and if the receiving mail server does not offer opportunistic encryption all data is being transmitted as clear-text.

For normal security requirements this is fully sufficient.

However, if for any reason you require a higher level of security regarding your oligonuleotide sequences, we recommend that you either stay with the printed oligo certificate on paper or download the digital oligo certificate from your Web archive on our site. In the latter case not only is the transmission encrypted, but also does the use of digital certificates ensure that the data is actually downloaded directly from the biomers.net Web server. It is very difficult to intercept data in this scenario.  

Payment

 

What payment options are available?

Within Germany, you can pay your order preferably by bank transfer. Other payment methods like prepayment or credit card are also accepted. 

Please note:
For orders from outside the EU, we kindly ask for prepayment. As soon as we receive the payment from you, the synthesis of your oligos is started immediately. You can perform payment by credit card or bank transfer. Please let us know when ordering which payment method you prefer. 

Credit account

We'll be happy to etablish a credit account for you, so your orders can be conveniently balanced to it. The credit account is without any time limit.

The practical approach would be as follows: You transfer to us the desired money amount, which always includes the VAT. After payment you are able to dispose of credit. With each delivery, you will receive an invoice, labeled with "call order, already paid invoice". 
Enter in your order "charge with credit account" (for online orders in the comment box "Note"), so that we know which orders should be paid with credit account. Orders without such a notice shall be paid separately. In this way, you are able to dispose very efficiently of your credit account. 

Contact

 

Contact: Who can I contact if I have some questions?

If you have questions or if you need help with the selection of your oligonucleotides to perfectly fit your research, please do not hesitate to contact us. 
Tel +49 731 70 396 0 , e-mail at info@biomers.net or our contact form. You can reach us every working day from 7 am to 7 pm.